hag [2017-10-31 11:35:13]

flagellin protein, about 20,000 subunits make up one flagellum

Locus: BSU35360

Isoelectric point: 4.78

Molecular weight: 32.47 kDa

Protein length: 304 aa

Gene length: 912 bp

Function: motility and chemotaxis

Product: flagellin protein

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → Genetic competence
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Flagellar proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for efficient pellicle biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming
• Groups of genes → Secreted proteins

Gene

Coordinates: 3,634,987 → 3,635,901

Phenotypes of a mutant

• no swarming motility on B medium. PubMed
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed
• few hours delay in pellicle development PubMed
• mutant has increased fitness in planktonic culture when competed with the wild-type NCIB3610 strain PubMed

The protein

Protein family

• bacterial flagellin family (according to Swiss-Prot)

Paralogous protein(s)

• YvzB (C-terminal domain of Hag)

Structure

• 3A5X (from Salmonella typhimurium, 42% identity) PubMed
• the structure of flagellar filaments: PubMed

Localization

• extracellular (no signal peptide), major component of the secretome PubMed
• membrane PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: hag
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • repressed during growth in the presence of branched chain amino acids (CodY) PubMed

Other regulations

• CsrA: translation inhibition, PubMed

Biological materials

Mutant

• GP901 (aphA3), GP902 (tet) PubMed, both available in Jörg Stülke's lab
• 1A915 ( hag::cat), PubMed, available at BGSC
• 1A783 ( hag::erm), PubMed, available at BGSC
• 1A842 ( hag::kan), PubMed, available at BGSC
• DS1677 (marker-less in NCIB3610) PubMed
• BKE35360 (Δhag::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
• BKK35360 (Δhag::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG

Expression vector

• expression in B. subtilis, in pBQ200: pGP1089, available in Jörg Stülke's lab

LacZ fusion

• pGP1035 (in pAC6), pGP755 (in pAC7), there is also a series of promoter deletion variants in pAC6 and pAC7 PubMed, all available in Jörg Stülke's lab

GFP fusion

• BP494 (bglS:: (hag-promoter-cfp-aphA3)), BP496 (amyE:: (hag-promoter-iyfp-cat)), available in Jörg Stülke's lab

Labs working on this gene/protein

• Daniel Kearns

References

Reviews

Loading

Original Publications

Loading